NMR Studies of PT Anti-cancer Drug Interactions with DNA and Related Compounds PDF Download

Author: Michael D. Reily
Publisher:
ISBN:
Category : Cancer
Languages : en
Pages : 292

View

Book Description

Author: Danzhou Yang
Publisher:
ISBN:
Category :
Languages : en
Pages :

View

Book Description
Chemotherapy with anticancer drugs is one of the main method of cancer treatment. The exploitation of the stereochemical interactions between anticancer drugs and DNA is of great importance for the ultimate clinical advances of cancer chemotherapy, which needs the detailed structural knowledge of DNA, drugs, and their interactions. Cisplatin is one of the most effecient and widely used anticancer drugs in the world. Extensive effort has been devoted to designing the new better anticancer platinum compounds. The structural studies on interactions of two anticancer platinum compounds, cisplatin and the third-generation bisplatinum compound 1,1/t,t, with DNA are described in this thesis. The structure of an intrastrand cisplatin-crosslinked didentate DNA duplex consisting of d(CCTG$rmsp*Gsp*$TCC) and its complement d(GGACCAGG) is determined by NMR spectroscopy. The refined duplex is unwound ($sim{-}21spcirc$) and kinked (${sim}58spcirc$) toward the major groove at the $rm Gsp*Gsp*$ site and the minor groove is significantly widened. The stability of the major intrastrand cisplatin-G$rmsp*pGsp*$ adduct has been studied and this intrastrand cisplatin-crosslinked adduct appears to be converted into an interstrand crosslink adduct. Three palindromic DNA oligonucleotides, each having a single intrastrand cisplatin crosslinked at GpG site, have also been studied by NMR spectroscopy. The structural consequence of the incorporation of the $rm Gsp*Gsp*$ lesions into palindromic sequences is dependent on the location of the lesion sites in the sequence. Such alternative structural distortions may be relevant in understanding the protein recognition of the cisplatin-induced lesions. A new anticancer bisplatinum compound 1,1/t,t exhibits excellent cytotoxicity towards cisplatin-resistant cancer cells. The structure of the interstrand adduct of 1,1/t,t with a palindromic DNA oligomer CATGCATG has been determined by NMR spectroscopy. Upon platination by 1,1/t,t, the DNA octamer forms a novel hairpin structure with the platinated G$sb4$ residue adopting a syn conformation and with the guanine base in the minor groove. Two such hairpins stack end-over-end and are linked together by the butanediamine tether to form a dumbbell structure. Such unusual structural distortion induced by the bisplatinum compound is completely different from that of the anticancer drug cisplatin-DNA adduct and may provide clues to explain the distinct biological activities of the two compounds. Anthracycline antibiotics are important anticancer intercalative drugs. The solution structures of anticancer anthracycline drugs aclacinomycin A and B, nogalamycin and disnogalamycin, complexed to a DNA hexamer have all been determined by high resolution NMR spectroscopy. Structural modification of DNA through covalent interactions have significant functional consequences and/or anticancer activities. Structural analysis of the C$sp2$-methyl-hypoxanthine:Cytosine base pair and O$sp6$-ethyl-Guanine:Cytosine base pair in B-DNA help understand their biological functions.

Author: Donald S. Thomas
Publisher:
ISBN:
Category : Cancer
Languages : en
Pages : 202

View

Book Description
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5;N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5o-d(TCTCCTATTCGCTTATCTCTC)-3o·5o- d(GAGAGATAAGCGAATAGGAGA)-3o (VB12), 5o-d(TCTCCTTCTTGTTCTTCCTCC)- 3o·5o-d(GGATTAAGAACAAGAAGGAGA)-3o (VB14) and 5o- d(CTCTCTCTATTGTTATCTCTTCT)-3o·5o-d(AGAAGAGATAACTATAGAGAGAG)-3o (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3o→3o and 5o→5o directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5o→5o direction.

Author: Bernhard Lippert
Publisher: John Wiley & Sons
ISBN: 9783906390208
Category : Medical
Languages : en
Pages : 628

View

Book Description
30 years after its discovery as an antitumor agent, cisplatin represents today one of the most successful drugs in chemotherapy. This book is intended to reminisce this event, to take inventory, and to point out new lines of development in this field. Divided in 6 sections and 22 chapters, the book provides an up-to-date account on topics such as - the chemistry and biochemistry of cisplatin, - the clinical status of Pt anticancer drugs, - the impact of cisplatin on inorganic and coordination chemistry, - new developments in drug design, testing and delivery. It also includes a chapter describing the historical development of the discovery of cisplatin. The ultimate question - How does cisplatin kill a cell? - is yet to be answered, but there are now new links suggesting how Pt binding to DNA may trigger a cascade of cellular reactions that eventually result in apoptosis. p53 and a series of damage recognition proteins of the HMG-domain family appear to be involved. The book addresses the problem of mutagenicity of Pt drugs and raises the question of the possible relevance of the minor DNA adducts, e.g. of interstrand cross-links, and the possible use of trans-(NH3)2Pt(II)-modified oligonucleotides in antisense and antigene strategies. Our present understanding of reactions of cisplatin with DNA is based upon numerous model studies (from isolated model nucleobases to short DNA fragments) and application of a large body of spectroscopic and other physico-chemical techniques. Thanks to these efforts there is presently no other metal ion whose reactions with nucleic acids are better understood than Pt. In a series of chapters, basic studies on the interactions of Pt electrophiles with nucleobases, oligonucleotides, DNA, amino acids, peptides and proteins are reported, which use, among others, sophisticated NMR techniques or X-ray crystallography, to get remarkable understanding of details on such reactions. Reactivity of cisplatin, once bound to DNA and formerly believed to be inert enough to stay, is an emerging phenomenon. It has (not yet) widely been studied but is potentially extremely important. Medicinal bioinorganic chemistry - the role of metal compounds in medicine - has received an enormous boost from cisplatin, and so has bioinorganic chemistry as a whole. There is hardly a better example than cisplatin to demonstrate what bioinorganic chemistry is all about: The marriage between classic inorganic (coordination) chemistry and the other life sciences - medicine, pharmacy, biology, biochemistry. Cisplatin has left its mark also on areas that are generally considered largely inorganic. The subject of mixed-valance Pt compounds is an example: From the sleeping beauty it made its way to the headlines of scientific journals, thanks to a class of novel Pt antitumor agents, the so-called "platinum pyrimidine blues". In the aftermath diplatinum (III) compounds were recognized and studies in large numbers, and now an organometalic chemistry of these diplatinum (III) species is beginning to emerge. The final section of the book is concerned with new developments such as novel di- and trinuclear Pt(II) drugs with DNA binding properties different from those of cisplatin, with orally active Pt(IV) drugs which are presently in clinical studies, and with attempts to modify combinatorial chemistry in such a way that it may become applicable to fast screening of Pt antitumor drugs. The potential of including computational methods in solving questions of Pt-DNA interactions is critically dealt with in the concluding chapter.

Author: Diane Marsh Riebeth
Publisher:
ISBN:
Category : Antimitotic agents
Languages : en
Pages : 340

View

Book Description

Author: Chenyang Lian
Publisher:
ISBN:
Category :
Languages : en
Pages : 316

View

Book Description

Author: Robert C. Bast, Jr.
Publisher: John Wiley & Sons
ISBN: 111900084X
Category : Medical
Languages : en
Pages : 2004

View

Book Description
Holland-Frei Cancer Medicine, Ninth Edition, offers a balanced view of the most current knowledge of cancer science and clinical oncology practice. This all-new edition is the consummate reference source for medical oncologists, radiation oncologists, internists, surgical oncologists, and others who treat cancer patients. A translational perspective throughout, integrating cancer biology with cancer management providing an in depth understanding of the disease An emphasis on multidisciplinary, research-driven patient care to improve outcomes and optimal use of all appropriate therapies Cutting-edge coverage of personalized cancer care, including molecular diagnostics and therapeutics Concise, readable, clinically relevant text with algorithms, guidelines and insight into the use of both conventional and novel drugs Includes free access to the Wiley Digital Edition providing search across the book, the full reference list with web links, illustrations and photographs, and post-publication updates

Author: Carmen Avendaño
Publisher: Elsevier
ISBN: 0444626670
Category : Science
Languages : en
Pages : 767

View

Book Description
Medicinal Chemistry of Anticancer Drugs, Second Edition, provides an updated treatment from the point of view of medicinal chemistry and drug design, focusing on the mechanism of action of antitumor drugs from the molecular level, and on the relationship between chemical structure and chemical and biochemical reactivity of antitumor agents. Antitumor chemotherapy is a very active field of research, and a huge amount of information on the topic is generated every year. Cytotoxic chemotherapy is gradually being supplemented by a new generation of drugs that recognize specific targets on the surface or inside cancer cells, and resistance to antitumor drugs continues to be investigated. While these therapies are in their infancy, they hold promise of more effective therapies with fewer side effects. Although many books are available that deal with clinical aspects of cancer chemotherapy, this book provides a sorely needed update from the point of view of medicinal chemistry and drug design. Presents information in a clear and concise way using a large number of figures Historical background provides insights on how the process of drug discovery in the anticancer field has evolved Extensive references to primary literature

Author: Lloyd R. Kelland
Publisher: Springer Science & Business Media
ISBN:
Category : Medical
Languages : en
Pages : 370

View

Book Description
Leading international experts comprehensively review all aspects of platinum anticancer drugs and their current use in treatment, as well as examining their future therapeutic prospects. Writing from a variety of disciplines, these authorities discuss the chemistry of cisplatin in aqueous solution, the molecular interaction of platinum drugs with DNA, and such exciting new areas as DNA mismatch repair and replicative bypass, apoptosis, and the transport of platinum drugs into tumor cells. The emergent platinum drugs of the future-orally active agents, the sterically hindered ZD0473, and the polynuclear charged platinum BBR3464-are also fully considered. Timely and interdisciplinary, Platinum-Based Drugs in Cancer Therapy offers cancer therapeutics specialists an illuminating survey of every aspect of platinum drugs from mechanisms of action to toxicology, tumor resistance, and new analogs.

Author: Yutaka Ito
Publisher: Royal Society of Chemistry
ISBN: 1839160934
Category : Science
Languages : en
Pages : 322

View

Book Description
In-cell NMR spectroscopy is a relatively new field. Despite its short history, recent in-cell NMR-related publications in major journals indicate that this method is receiving significant general attention. This book provides the first informative work specifically focused on in-cell NMR. It details the historical background of in-cell NMR, host cells for in-cell NMR studies, methods for in-cell biological techniques and NMR spectroscopy, applications, and future perspectives. Researchers in biochemistry, biophysics, molecular biology, cell biology, structural biology as well as NMR analysts interested in biological applications will all find this book valuable reading.