Molecular Modelling and NMR Studies of Multinuclear Platinum Anticancer Complexes PDF Download
Are you looking for read ebook online? Search for your book and save it on your Kindle device, PC, phones or tablets. Download Molecular Modelling and NMR Studies of Multinuclear Platinum Anticancer Complexes PDF full book. Access full book title Molecular Modelling and NMR Studies of Multinuclear Platinum Anticancer Complexes by Donald S. Thomas. Download full books in PDF and EPUB format.
Author: Donald S. Thomas Publisher: ISBN: Category : Cancer Languages : en Pages : 202
Book Description
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5;N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5o-d(TCTCCTATTCGCTTATCTCTC)-3o·5o- d(GAGAGATAAGCGAATAGGAGA)-3o (VB12), 5o-d(TCTCCTTCTTGTTCTTCCTCC)- 3o·5o-d(GGATTAAGAACAAGAAGGAGA)-3o (VB14) and 5o- d(CTCTCTCTATTGTTATCTCTTCT)-3o·5o-d(AGAAGAGATAACTATAGAGAGAG)-3o (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3o→3o and 5o→5o directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5o→5o direction.
Author: Donald S. Thomas Publisher: ISBN: Category : Cancer Languages : en Pages : 202
Book Description
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5;N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5o-d(TCTCCTATTCGCTTATCTCTC)-3o·5o- d(GAGAGATAAGCGAATAGGAGA)-3o (VB12), 5o-d(TCTCCTTCTTGTTCTTCCTCC)- 3o·5o-d(GGATTAAGAACAAGAAGGAGA)-3o (VB14) and 5o- d(CTCTCTCTATTGTTATCTCTTCT)-3o·5o-d(AGAAGAGATAACTATAGAGAGAG)-3o (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3o→3o and 5o→5o directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5o→5o direction.
Author: Rasha A. Ruhayel Publisher: ISBN: Category : Antineoplastic agents Languages : en Pages :
Book Description
In the 1980's, Nicholas Farrell developed a range of structurally distinct multinuclear Pt complexes that form long-range interstrand crosslinks (IXLs) in DNA. The dinuclear complex [{trans-PtCl2(NH3)}2-æ-(H2N(CH2)6NH2)]2+ (1,1/t,t) was the first of this series to show promising results, however, it was the trinuclear complex [{trans-PtCl2(NH3)}2-æ-trans-Pt(NH3)2(H2N(CH2)6NH2)2]4+ (1,0,1/t,t,t or BBR3464) that was chosen for clinical trials based on significantly increased cytotoxicity compared to 1,1/t,t and cisplatin. Molecular biology experiments have shown that 1,1/t,t exclusively forms IXLs in DNA in the 5'{602} 5' direction, whilst 1,0,1/t,t,t can form IXLs in both the 5'{602}5' and 3'{602}3' directions. Previously, 2D [1H,15N] HSQC NMR has been used to study the formation of 5' 5' 1,4 GG IXLs. The formation of 3' 3' 1,4 GG IXLs have been studied as part of this thesis. More recently, Pt complexes such as [{trans PtCl2(NH3)}2{H2N(CH2)6(NH2(CH2)2NH2)(CH2)6NH2}]4+ (1,1/t,t 6,2,6) and [{trans PtCl2(NH3)}2{H2N(CH2)6(NH2)(CH2)6NH2}]3+ (1,1/t,t 6,6), where the charged central Pt moiety of 1,0,1/t,t,t is replaced by a polyamine linker, have been developed in the Farrell group and show increased potency compared to 1,0,1/t,t,t. The complex 1,1/t,t 6,2,6 is a lead candidate currently undergoing Phase I clinical trials. Prior to the work presented in this thesis, little was known about the aquation chemistry or kinetics of DNA binding of these novel complexes. Reported in Chapter 3 is the study of the formation of 3' 3' 1,4 GG IXLs by both 1,0,1/t,t,t and 1,1/t,t in the duplex 5' {d(TATACATGTATA)2} (33 14XL) (pH 5.4, 298K). A combination of 1D 1H and 2D [1H, 15N] HSQC NMR experiments was used to directly compare the results with the stepwise formation of the 5' 5' 1,4 GG IXL with the previously studied duplex, 5' {d(ATATGTACATAT)2} (55 14XL), under the same conditions. Preassociation as well as aquation were similar, however, differences were observed at the monofunctional binding step with evidence for numerous monofunctional adducts. Both reactions did not yield a single 3' 3' 1,4 GG IXL, rather several adducts that could not be characterised. Molecular dynamics simulations of the 3' 3' 1,4 GG IXLs showed highly distorted lesions that may have implication in cellular repair processes.
Author: Justin Jeff Wilson Publisher: ISBN: Category : Languages : en Pages : 345
Book Description
(cont'd) Chapter 6. Synthesis, Characterization, and Cytotoxicity of Platinum(IV) Dicarbamate Complexes The reaction of cis,cis,trans-[Pt(NH3)2Cl2(OH)2] with alkyl and aryl isocyanates (RNCO) in DMF afforded dicarbamate complexes of the general formula cis,cis,trans- [Pt(NH 3)2Cl 2(O 2CNHR)2]. The resulting complexes were fully characterized by X-ray crystallography, multinuclear NMR spectroscopy, and cyclic voltammetry. The anticancer activities of these complexes were assessed in human lung cancer (A549) and human lung fibroblast (MRC-5) cell lines. Although no clear structure-activity relationships could be delineated, the complexes exhibited activity on the same order of magnitude as that of the clinically established drug cisplatin. Therefore, the reaction of cis,cis,trans-[Pt(NH3)2Cl 2(OH)2] with isocyanates provides a powerful new synthetic pathway to functionalize platinum(IV) anticancer agents. Appendix A. Aqueous Electrochemistry of a Platinum(IV) Prodrug Electrochemical studies of cis,cis,trans-[Pt(NH3)2Cl2(OAc) 2] in aqueous media were carried out. Cyclic voltammetry in pH 7.4 phosphate-buffered saline with glassy carbon and Pt disk working electrodes gave substantially different peak potentials for the irreversible reduction feature. Under these conditions, the glassy carbon electrode was plated with platinum metal derived from the platinum(IV) complex, as determined by cyclic voltammetry and chronoamperometry experiments. The bulk electrolysis of cis,cis,trans-[Pt(NH3)2Cl2(OAc)2] in aqueous solution at a carbon felt working electrode was investigated by 1H NMR spectroscopy. These studies indicate ligand loss upon reduction from both axial and equatorial sites of the platinum(IV) complex. Appendix B. Targeting the Mitochondria with Platinum Anticancer Agents using Mitochondria-Penetrating Peptides Early results of a collaborative effort with the lab of Professor Shana 0. Kelley at the University of Toronto to deliver platinum anticancer agents to the mitochondria are presented. Succinylacetone (Hsuccac) was used as a leaving group ligand for a cis-diammineplatinum(II) complex. The complex [Pt(succac)(NH 3)2](NO3), which contains a terminal, uncoordinated carboxylic acid functional group, was prepared and fully characterized. This complex was conjugated to a mitochondria-penetrating peptide (MPP) using standard solid-phase coupling chemistry. The anticancer activity of the Pt-MPP construct was tested in both wild-type and cisplatin-resistant ovarian cancer cell lines, A2780 and A2780CP70. Although less potent than cisplatin, the construct is equally toxic to both cell lines, thereby indicating that targeting the mitochondria provides a viable strategy for circumventing resistance to platinum drugs. Appendix C. Synthesis and Characterization of Several Novel Platinum Complexes Throughout the course of this thesis work, several platinum complexes were synthesized and characterized, but ultimately not fully pursued as potential anticancer agents. These species include platinum compounds with dichloroacetate, 2,2'-bis(1- methylimidazolyl)phenylmethoxymethane (BIPhMe), nitrogen mustard-containing, and nitroimidazole-derivatized ligands. The syntheses and characterization of these compounds are reported. Crystal structures are described for several of them.
Author: Bernhard Lippert Publisher: John Wiley & Sons ISBN: 9783906390208 Category : Medical Languages : en Pages : 628
Book Description
30 years after its discovery as an antitumor agent, cisplatin represents today one of the most successful drugs in chemotherapy. This book is intended to reminisce this event, to take inventory, and to point out new lines of development in this field. Divided in 6 sections and 22 chapters, the book provides an up-to-date account on topics such as - the chemistry and biochemistry of cisplatin, - the clinical status of Pt anticancer drugs, - the impact of cisplatin on inorganic and coordination chemistry, - new developments in drug design, testing and delivery. It also includes a chapter describing the historical development of the discovery of cisplatin. The ultimate question - How does cisplatin kill a cell? - is yet to be answered, but there are now new links suggesting how Pt binding to DNA may trigger a cascade of cellular reactions that eventually result in apoptosis. p53 and a series of damage recognition proteins of the HMG-domain family appear to be involved. The book addresses the problem of mutagenicity of Pt drugs and raises the question of the possible relevance of the minor DNA adducts, e.g. of interstrand cross-links, and the possible use of trans-(NH3)2Pt(II)-modified oligonucleotides in antisense and antigene strategies. Our present understanding of reactions of cisplatin with DNA is based upon numerous model studies (from isolated model nucleobases to short DNA fragments) and application of a large body of spectroscopic and other physico-chemical techniques. Thanks to these efforts there is presently no other metal ion whose reactions with nucleic acids are better understood than Pt. In a series of chapters, basic studies on the interactions of Pt electrophiles with nucleobases, oligonucleotides, DNA, amino acids, peptides and proteins are reported, which use, among others, sophisticated NMR techniques or X-ray crystallography, to get remarkable understanding of details on such reactions. Reactivity of cisplatin, once bound to DNA and formerly believed to be inert enough to stay, is an emerging phenomenon. It has (not yet) widely been studied but is potentially extremely important. Medicinal bioinorganic chemistry - the role of metal compounds in medicine - has received an enormous boost from cisplatin, and so has bioinorganic chemistry as a whole. There is hardly a better example than cisplatin to demonstrate what bioinorganic chemistry is all about: The marriage between classic inorganic (coordination) chemistry and the other life sciences - medicine, pharmacy, biology, biochemistry. Cisplatin has left its mark also on areas that are generally considered largely inorganic. The subject of mixed-valance Pt compounds is an example: From the sleeping beauty it made its way to the headlines of scientific journals, thanks to a class of novel Pt antitumor agents, the so-called "platinum pyrimidine blues". In the aftermath diplatinum (III) compounds were recognized and studies in large numbers, and now an organometalic chemistry of these diplatinum (III) species is beginning to emerge. The final section of the book is concerned with new developments such as novel di- and trinuclear Pt(II) drugs with DNA binding properties different from those of cisplatin, with orally active Pt(IV) drugs which are presently in clinical studies, and with attempts to modify combinatorial chemistry in such a way that it may become applicable to fast screening of Pt antitumor drugs. The potential of including computational methods in solving questions of Pt-DNA interactions is critically dealt with in the concluding chapter.
Author: Steef van de Velde Publisher: Springer Science & Business Media ISBN: 148990218X Category : Medical Languages : en Pages : 349
Book Description
The 7th International Symposium on Platinum and other metal coordination compounds in Cancer Chemotherapy, ISPCC '95, organized by the European Cancer Centre, was held in Amsterdam, the Netherlands, March 1-4, 1995. As with previous ISPCC meetings, the goal of ISPCC '95 was to bring together c1inicians, clinical investigators, scientists, and laboratory workers from many disciplines to promote further collaboration and cooperation in the development of new platinum and other metal coordination compounds as weil as in new ways to use 'c1assical' drugs as cisplatin and carboplatin in the treatment of cancer. Important aspects addressed by experts in the field inc1uded the synthesis and activity of new platinum compounds, the biochemistry and molecular pharrnacology as weil as the c1inical pharrnacology of this c1ass of antineoplastic agents, an overview of current c1inical studies, one special minisymposium on the mechanisms of cell kill of platinum, and one on resistance against platinum compounds. Finally, the current status of development of nonplatinum metal complexes was discussed. This volume contains the contributions of the various speakers at ISPCC '95 and provides an up-to-date and comprehensive overview of this important c1ass of anticancer agents, ranging from synthesis and molecular pharrnacology on one hand to c1inical pharrnacology and cIinical investigations on the other hand. The Organizing Corrunittee and Editors wish to express their gratitude to the contributors to this volume, to the various organizations and pharrnaceutical companies for their generous sponsoring of ISPCC '95, and to the Plenum Publishing Company for their help in producing this volume.
Author: Lloyd R. Kelland Publisher: Springer Science & Business Media ISBN: Category : Medical Languages : en Pages : 370
Book Description
Leading international experts comprehensively review all aspects of platinum anticancer drugs and their current use in treatment, as well as examining their future therapeutic prospects. Writing from a variety of disciplines, these authorities discuss the chemistry of cisplatin in aqueous solution, the molecular interaction of platinum drugs with DNA, and such exciting new areas as DNA mismatch repair and replicative bypass, apoptosis, and the transport of platinum drugs into tumor cells. The emergent platinum drugs of the future-orally active agents, the sterically hindered ZD0473, and the polynuclear charged platinum BBR3464-are also fully considered. Timely and interdisciplinary, Platinum-Based Drugs in Cancer Therapy offers cancer therapeutics specialists an illuminating survey of every aspect of platinum drugs from mechanisms of action to toxicology, tumor resistance, and new analogs.
Author: Shahid Ul-Islam Publisher: John Wiley & Sons ISBN: 1119640423 Category : Science Languages : en Pages : 432
Book Description
This book is organized into 12 important chapters that focus on the progress made by metal-based drugs as anticancer, antibacterial, antiviral, anti-inflammatory, and anti-neurodegenerative agents, as well as highlights the application areas of newly discovered metallodrugs. It can prove beneficial for researchers, investigators and scientists whose work involves inorganic and coordination chemistry, medical science, pharmacy, biotechnology and biomedical engineering.
Author: Donald S. Thomas
Author: Donald S. Thomas
Author: Rasha A. Ruhayel
Author: John William Cox
Author: Stephen Oliver Dunham
Author: Justin Jeff Wilson
Author: Lori L. Bennett Slavin
Author: Bernhard Lippert
Author: Steef van de Velde
Author: Lloyd R. Kelland
Author: Shahid Ul-Islam