A Brief History of Everyone Who Ever Lived PDF Download
Are you looking for read ebook online? Search for your book and save it on your Kindle device, PC, phones or tablets. Download A Brief History of Everyone Who Ever Lived PDF full book. Access full book title A Brief History of Everyone Who Ever Lived by Adam Rutherford. Download full books in PDF and EPUB format.
Author: Adam Rutherford Publisher: Hachette UK ISBN: 1615194185 Category : Science Languages : en Pages : 532
Book Description
National Book Critics Circle Award—2017 Nonfiction Finalist “Nothing less than a tour de force—a heady amalgam of science, history, a little bit of anthropology and plenty of nuanced, captivating storytelling.”—The New York Times Book Review, Editor's Choice A National Geographic Best Book of 2017 In our unique genomes, every one of us carries the story of our species—births, deaths, disease, war, famine, migration, and a lot of sex. But those stories have always been locked away—until now. Who are our ancestors? Where did they come from? Geneticists have suddenly become historians, and the hard evidence in our DNA has blown the lid off what we thought we knew. Acclaimed science writer Adam Rutherford explains exactly how genomics is completely rewriting the human story—from 100,000 years ago to the present.
Author: Adam Rutherford Publisher: The Experiment, LLC ISBN: 1615194185 Category : Science Languages : en Pages : 532
Book Description
National Book Critics Circle Award—2017 Nonfiction Finalist “Nothing less than a tour de force—a heady amalgam of science, history, a little bit of anthropology and plenty of nuanced, captivating storytelling.”—The New York Times Book Review, Editor’s Choice A National Geographic Best Book of 2017 In our unique genomes, every one of us carries the story of our species—births, deaths, disease, war, famine, migration, and a lot of sex. But those stories have always been locked away—until now. Who are our ancestors? Where did they come from? Geneticists have suddenly become historians, and the hard evidence in our DNA has blown the lid off what we thought we knew. Acclaimed science writer Adam Rutherford explains exactly how genomics is completely rewriting the human story—from 100,000 years ago to the present.
Author: Adam Rutherford Publisher: George Weidenfeld & Nicholson ISBN: 9781780229072 Category : Medical Languages : en Pages : 0
Book Description
'A brilliant, authoritative, surprising, captivating introduction to human genetics. You'll be spellbound' Brian Cox This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be. *** 'A thoroughly entertaining history of Homo sapiens and its DNA in a manner that displays popular science writing at its best' Observer 'Magisterial, informative and delightful' Peter Frankopan 'An extraordinary adventure...From the Neanderthals to the Vikings, from the Queen of Sheba to Richard III, Rutherford goes in search of our ancestors, tracing the genetic clues deep into the past' Alice Roberts
Author: Adam Rutherford Publisher: Penguin UK ISBN: 0141970227 Category : Science Languages : en Pages : 327
Book Description
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Author: Adam Rutherford Publisher: The Experiment, LLC ISBN: 1615195327 Category : Science Languages : en Pages : 303
Book Description
“Rutherford describes [The Book of Humans] as being about the paradox of how our evolutionary journey turned ‘an otherwise average ape’ into one capable of creating complex tools, art, music, science, and engineering. It’s an intriguing question, one his book sets against descriptions of the infinitely amusing strategies and antics of a dizzying array of animals.”—The New York Times Book Review Publisher’s Note: The Book of Humans was previously published in hardcover as Humanimal. In this new evolutionary history, geneticist Adam Rutherford explores the profound paradox of the human animal. Looking for answers across the animal kingdom, he finds that many things once considered exclusively human are not: We aren’t the only species that “speaks,” makes tools, or has sex outside of procreation. Seeing as our genome is 98 percent identical to a chimpanzee’s, our DNA doesn’t set us far apart, either. How, then, did we develop the most complex culture ever observed? The Book of Humans proves that we are animals indeed—and reveals how we truly are extraordinary.
Author: Adam Rutherford Publisher: Penguin ISBN: 1617230111 Category : Science Languages : en Pages : 291
Book Description
Today’s scientists are radically exceeding the boundaries of evolution and engineering entirely novel creatures. Cutting edge “synthetic biology” may lead to solutions to some of the world’s most pressing crises and pave the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.
Author: Jennifer Ouellette Publisher: Penguin ISBN: 1101613645 Category : Science Languages : en Pages : 370
Book Description
As diverse as people appear to be, all of our genes and brains are nearly identical. In Me, Myself, and Why, Jennifer Ouellette dives into the miniscule ranges of variation to understand just what sets us apart. She draws on cutting-edge research in genetics, neuroscience, and psychology-enlivened as always with her signature sense of humor-to explore the mysteries of human identity and behavior. Readers follow her own surprising journey of self-discovery as she has her genome sequenced, her brain mapped, her personality typed, and even samples a popular hallucinogen. Bringing together everything from Mendel's famous pea plant experiments and mutations in The X-Men to our taste for cilantro and our relationships with virtual avatars, Ouellette takes us on an endlessly thrilling and illuminating trip into the science of ourselves
Author: Rebecca Wragg Sykes Publisher: Bloomsbury Publishing ISBN: 1472937481 Category : Social Science Languages : en Pages : 417
Book Description
** WINNER OF THE PEN HESSELL-TILTMAN PRIZE 2021 ** 'Beautiful, evocative, authoritative.' Professor Brian Cox 'Important reading not just for anyone interested in these ancient cousins of ours, but also for anyone interested in humanity.' Yuval Noah Harari Kindred is the definitive guide to the Neanderthals. Since their discovery more than 160 years ago, Neanderthals have metamorphosed from the losers of the human family tree to A-list hominins. Rebecca Wragg Sykes uses her experience at the cutting edge of Palaeolithic research to share our new understanding of Neanderthals, shoving aside clichés of rag-clad brutes in an icy wasteland. She reveals them to be curious, clever connoisseurs of their world, technologically inventive and ecologically adaptable. Above all, they were successful survivors for more than 300,000 years, during times of massive climatic upheaval. Much of what defines us was also in Neanderthals, and their DNA is still inside us. Planning, co-operation, altruism, craftsmanship, aesthetic sense, imagination, perhaps even a desire for transcendence beyond mortality. Kindred does for Neanderthals what Sapiens did for us, revealing a deeper, more nuanced story where humanity itself is our ancient, shared inheritance.
Author: Adam Rutherford Publisher: Weidenfeld & Nicolson ISBN: 9780297609384 Category : Languages : en Pages : 320
Book Description
This is a story about you.It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species.In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.
Author: Adam Rutherford Publisher: Weidenfeld & Nicolson ISBN: 9781474611251 Category : Human evolution Languages : en Pages : 224
Book Description
Race is real because we perceive it. Racism is real because we enact it. But the appeal to science to strengthen racist ideologies is on the rise - and increasingly part of the public discourse on politics, migration, education, sport and intelligence. Stereotypes and myths about race are expressed not just by overt racists, but also by well-intentioned people whose experience and cultural baggage steer them towards views that are not supported by the modern study of human genetics. Even some scientists are uncomfortable expressing opinions deriving from their research where it relates to race. Yet, if understood correctly, science and history can be powerful allies against racism, granting the clearest view of how people actually are, rather than how we judge them to be. HOW TO ARGUE WITH A RACIST is a vital manifesto for a twenty-first century understanding of human evolution and variation, and a timely weapon against the misuse of science to justify bigotry.
Author: Adam Rutherford
Author: Adam Rutherford
Author: Adam Rutherford
Author: Adam Rutherford
Author: Adam Rutherford
Author: Adam Rutherford
Author: Jennifer Ouellette
Author: Rebecca Wragg Sykes
Author: Adam Rutherford
Author: Adam Rutherford
Author: Charles Van Doren